Home Print this page Email this page Small font sizeDefault font sizeIncrease font size
Users Online: 511
Home | About us | Editorial board | Search | Ahead of print | Current issue | Archives | Submit article | Instructions | Subscribe | Contacts | Login 
     


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2015  |  Volume : 5  |  Issue : 1  |  Page : 50-54  

Identification of Leishmania species by kinetoplast DNA-polymerase chain reaction for the first time in Khaf district, Khorasan-e-Razavi province, Iran


1 Skin Diseases and Cutaneous Leishmaniasis Research Center, Emam Reza Hospital, Mashhad University of Medical Sciences; Department of Medical Parasitology and Mycology, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran
2 Department of Medical Parasitology and Mycology, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran
3 Department of Immunology Research Center, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran
4 Department of Community Medicine, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

Date of Web Publication22-Jan-2015

Correspondence Address:
Salehi Sangani Ghodratollah
Department of Medical Parasitology and Mycology, School of Medicine, Mashhad University of Medical Sciences, Mashhad
Iran
Login to access the Email id


DOI: 10.4103/2229-5070.145587

PMID: 25709953

Rights and Permissions
   Abstract 

Context: Cutaneous leishmaniasis (CL) is an endemic parasitic skin disease in many parts of Iran including Khorasan province. Both clinical forms of the disease, anthroponotic cutaneous leishmaniasis (ACL) and zoonotic cutaneous leishmaniasis (ZCL) are present in this province. However, leishmaniasis molecular map is determined in four cities of Khorasan, but several foci still are remained unknown. Aim: The aim was to identify the species of Leishmania causing CL in Khaf, a District in Khorasan-e-Razavi province. Materials and Methods: Slide smears obtained from skin lesions of 120 patients suspected to leishmaniasis. Direct microscopy and polymerase chain reaction (PCR) performed using specific kinetoplast DNA primers. Data were analyzed with the use of SPSS. Results: Among 120 persons with skin ulcers suspected to CL, the results of direct smear of 54 (45%) samples were positive. PCR band were observed in 66 (55%) of examined samples in which 46 bands identified for Leishmania tropica and 20 for Leishmania major. Conclusion: Both ACL and ZCL are present in Khaf. L. tropica is the dominant causative species for ACL. Further study is recommended to discover probable reservoir and vector for L. major in Khaf.

Keywords: Cutaneous leishmaniasis, Khaf, Leishmania major, Leishmania tropica, polymerase chain reaction


How to cite this article:
Abdolmajid F, Ghodratollah SS, Hushang R, Mojtaba MB, Ali MM, Abdolghayoum M. Identification of Leishmania species by kinetoplast DNA-polymerase chain reaction for the first time in Khaf district, Khorasan-e-Razavi province, Iran. Trop Parasitol 2015;5:50-4

How to cite this URL:
Abdolmajid F, Ghodratollah SS, Hushang R, Mojtaba MB, Ali MM, Abdolghayoum M. Identification of Leishmania species by kinetoplast DNA-polymerase chain reaction for the first time in Khaf district, Khorasan-e-Razavi province, Iran. Trop Parasitol [serial online] 2015 [cited 2019 Jul 16];5:50-4. Available from: http://www.tropicalparasitology.org/text.asp?2015/5/1/50/145587


   Introduction Top


Cutaneous leishmaniasis (CL) is an endemic parasitic skin disease in 98 countries worldwide, with more than 350 million people at risk. [1] Two clinical forms of the disease are present in more than 15 provinces of Iran. At least 20,000 cases/year have been reported in Iran. [2] Anthroponotic cutaneous leishmaniasis (ACL) caused by Leishmania tropica usually in urban areas and zoonotic cutaneous leishmaniasis (ZCL) caused by Leishmania major mostly in rural regions. [3],[4] Both L. major and L. tropica are intracellular parasites transmitted through the bite of the female phlebotomine sand flies. [5] The Proven or suspected vectors of various leishmanias have reported 13 species of sand flies in Iran. Phlebotomus papatasi and Phlebotomus sergenti identified repeatedly as vector of L. major and L. tropica respectively in Khorasan-e-Razavi. [6]

Identification of Leishmania species is important for planning control measures and using treatment protocols. [1] However previous epidemiologic studies have been very useful to identify different foci in Khorasan, but there is not a perfect leishmaniasis map and exact data about the etiologic agents in many districts of this province. Although both L. tropica and L. major have reported from Mashhad and Sabzevar, previous Epidemiologic studies have indicated that ACL is the dominant only form of CL which is present in central and south Khorasan. [7],[8]

Many different polymerase chain reaction (PCR)-based techniques have been used for Leishmania diagnosis. However, the kinetoplast DNA (kDNA) PCR is considered to be the most sensitive method for diagnosis of leishmaniasis. [9] kDNA has a variable region which is known for most Leishmania species. Therefore, it is an ideal target for discrimination between species. [10] The other studies have been carried out for diagnosis of leishmaniasis by kDNA-PCR. [7],[11],[12],[13] We also used this method in current study.

To identify the species of Leishmania causing different clinical presentations of CL in Khaf, a district in Khorasan province, a study was undertaken over a period of 2 years (April 2011 to March 2013), at health center and 22-Bahman Hospital of Khaf and Departments of Parasitology and Immunology, School of Medicine, Mashhad University of Medical Sciences.


   Materials and methods Top


Study area

Khaf district is located between the longitude 59° 28' to 60° 56' and the latitude 33° 40' to 35° 05' with 9,228 km 2 . Khaf is bordered from east with Afghanistan. Khaf altitude is 970 m above sea level with warm and dry climates and situated 260 km south of Mashhad, the capital of Khorasan-e-Razavi province [Figure 1]. The population of this county is about 110,000 included 56% inhabit in rural areas and 44% urban areas.
Figure 1: Geographical map of Khaf district, Khorasan-e-Razavi province, Iran

Click here to view



   Sampling Top


In this cross-sectional study, the study population was those peoples who had at least one skin ulcer suspected to CL and introduced to clinical laboratories of health center and 22-Bahman Hospital in Khaf city for direct examination.

In order to collect demographic and clinical information by a questionnaire, an informed consent form was obtained from each individual or his/her attendant. To prepare two direct Giemsa stained smears (for direct examination and DNA extraction), samples obtained by scraping from the center and edge of each skin lesion using a sterile scalpel. Each smear examined by an expert microscopist and then kept for DNA extraction.


   Parasitological test Top


Giemsa stained slides were observed under a light microscope with high magnification (×1000) by an expert individual. The results of microscopic test recorded. The slides kept in the boxes for DNA extraction.


   DNA extraction Top


For DNA extraction, each slide smear was scraped and DNA extraction was carried out by DNA extraction kit (GeNet Bio, Korea). Briefly, the tissues on the slides should be suspended in lysis buffer (TL buffer). Then DNA extraction performed according to manufacturer's instructions step by step. DNA was stored in the freezer for the PCR test. [11]


   Polymerase chain reaction amplification Top


Polymerase chain reaction performed with specific primers of kDNA pattern of L. donovani (F: 5'TCGCAGAACGCCCCTACC3') and (R: 5'AGGGGTTGGTGTAAAATAGG3') (Tuba-Negin, Iran) that produced 615 bp fragment for L. major and 744 bp fragment for L. tropica. Amplification reaction mixture (25 μl) contained 20 μl PCR mixtures (dNTP's, MgCl 2 , primers and Taq DNA polymerase) and 5 μl extracted DNA. [13]

Amplification performed by a PCR Thermal Cycler-PC 818 (ASTEC, Japan) under the following conditions: Initial denaturation for 5 min at 95°C, followed by 38 cycles of 94°C for 30 s, 60°C for 45 s, 72°C for 60 s, ending by final extension at 72°C for 7 min. In every round of PCR two standard sample for L. major (strain MRHO/IR/75/ER) and for L. tropica (strain MHOM/01/IR/YAZA) as a positive control and distilled water as negative control were used.

Polymerase chain reaction products were analyzed by 1.5% agarose gel electrophoresis and visualized by  Uvitec System DOC-008.XD (UVItec Ltd, Cambridge, UK) after staining with ethidium bromide. 100 bp DNA Ladder was also used as the DNA size marker. Single fragments of 615 bp and 744 bp are indicative of the species L. major and L. tropica, respectively [Figure 2]. Statistical data analysis was performed using Chi-square tests in the software  SPSS 11.5 software for Windows, (SPSS Inc., Chicago, IL, USA).
Figure 2: Electrophoresis of DNA samples obtained from direct smears of patients with cutaneous leishmaniasis from Khaf

Click here to view



   Results Top


A total of 120 cases aged 1-70 years old, comprising 81 (67.5%) males and 39 (32.5%) females were included in this study. Amastigotes of Leishmania recognized by Giemsa stained smears obtained from 54 (45%) patients. All the samples were examined by PCR method. PCR band observed in 66 (55%) cases included 46 L. tropica and 20 L. major. The result of PCR and direct stained smears compared with each other [Table 1].
Table 1: Comparison between the result of PCR and direct stained smears obtained from 120 patients from Khaf with skin lesions suspected to CL


Click here to view


About 80% of lesions caused by L. major are ulcerative while 74% of lesions caused by L. tropica are nodular and not ulcerative. Furthermore, according to questionnaires, all of the patients suffering from L. major infection had a history of travel to endemic areas [Table 2].
Table 2: Clinical presentation and place of infection in patients from Khaf district suffering from CL according to species of Leishmania

Click here to view



   Discussion Top


One of the challenges regarding the CL control and diagnosis is inadequate data of the healthcare system about epidemiological conditions. [14] Characterization and identification of Leishmania species is necessary, because different forms of CL caused by different species may require special control measures and treatment programs. In addition, epidemiological studies, the distribution of Leishmania species in human, reservoirs, and vectors is a prerequisite for designing appropriate control programs. [15],[16]

Based on previous experiments, we used PCR method for diagnosis and characterization of Leishmania species on extracted DNA obtained from Giemsa stained smears. [16],[17],[18],[19]

Direct microscopy of scrapings taken from the margins of skin lesions is a common method for clinical diagnosis of leishmaniasis in most of the clinical laboratories. Comparison of PCR method and Direct microscopy on Giemsa stained slides indicate the higher sensitivity of PCR method. [7],[11] Furthermore, the results of the current study showed that PCR is a high sensitive method for identification of Leishmania species. Of the 120 Giemsa stained smears prepared from the skin ulcer of patients suspected to CL, 54 (45%) were positive by microscopic method, whereas 66 (55%) of these were positive by PCR.

In the current study, DNA extraction performed by scraping direct stained smears. These samples are proper for DNA extraction in comparison with promastigotes obtained from RPMI culture. [20],[21],[22]

Kinetoplast DNA is one of the genetic targets that has been applied and proved to be useful for detection of Leishmania species in clinical specimens. [14],[20],[21],[22] The minicircle of kDNA is an ideal target, since there are approximately 10,000 copies of minicircles per parasite that are distributed among about 10 different sequence classes and are between 600 and 800 bp in size in members of the genus Leishmania. [9] The minicircle is divided into a conserved region and a variable region. The first region is conserved throughout the genus Leishmania and in some other trypanosomatids as well. These conserved sequences have high potential for PCR primer designing. These primers can amplify various minicircle classes from all Leishmania species. The high copy number of the Leishmania minicircles makes them an ideal target for diagnostic tools. [23]

Hence far it has seemed that the only form of leishmaniasis is ACL in the study area. Result of this study provides new insight about treatment and control measures of CL for clinicians and public health authorities. Treatment of patients with CL has performed based on clinical manifestations alone whereas differentiation of CL forms is impossible in this way. Clinical presentation of the skin lesions did not show categorical relation with the species of parasite. Among the patients with ACL, 20% had exudative ulcers, while, in those who ZCL, 20% presented dry lesions in the shape of papule and nodule [Table 2]. This indicates that Clinical appearance of Skin ulcers does not determine the clinical form of CL as discussed by many investigators. [24],[25]

In this study, all of patients suffering from L. major infection had a history of travel to endemic areas. These patients were workers who had traveled and stayed in Damghan, Golestan province and Sarakhs, the known foci for ZCL. [24],[25],[26],[27] However both L. tropica and L. major isolated from the residence of Khaf district, but this indicates that the native and original etiologic agent for CL in the study area is L. tropica.


   Conclusion Top


However both L. tropica and L. major isolated from the residence of Khaf district, but we believe that the dominant and original species of Leishmania is L. tropica. All victims of L. major are the residents who have travelled to ZCL foci. To identify Probable animal reservoirs for approved original ZCL of Khaf further study is recommended.


   Acknowledgment Top


This article is a part of Student MS thesis No. 390-A in relation to a Research Project Code No. 900421 approved by Research Commission of Mashhad University of Medical Sciences. We thank the Vice-Chancellor for Research, for financial support of this study. We also would like to thank all the Lab. Staffs of 22 Bahman Hospital and Health Center in Khaf city specially Mr. Heydari, Miss. Rezaei and Miss. Rahmani for their sincere cooperation. We also express our gratitude to the members of the laboratory of immunology Department of School of Medicine specially Miss. Valizade and Miss. Ariaei for their technical helps in PCR assay.

 
   References Top

1.
Organization World Health. Control of the leishmaniases: Report of a Meeting of the WHO Expert Commitee on the Control of Leishmaniases. Organization World Health; Geneva: 2010.  Back to cited text no. 1
    
2.
Mohebali M, Motazedian M, Parsa F, Hajjaran H, Yaghoobi-Ershadi M. Identification of Leishmania species from different parts of Iran using a random amplified polymorphic DNA in humans, animal reservoirs and vectors. Med J Islam Repub Iran (MJIRI) 2002;15:243-6.  Back to cited text no. 2
    
3.
Ardehali S, Sodeiphy M, Haghighi P, Rezai H, Vollum D. Studies on chronic (lupoid) leishmaniasis. Ann Trop Med Parasitol 1980;74:439-45.  Back to cited text no. 3
    
4.
Yaghoobi-Ershadi MR, Hanafi-Bojd AA, Akhavan AA, Zahrai-Ramazani AR, Mohebali M. Epidemiological study in a new focus of cutaneous leishmaniosis due to Leishmania major in Ardestan town, central Iran. Acta Trop 2001;79:115-21.  Back to cited text no. 4
    
5.
Fata A, Mahmoudian M, Varasteh A, Sankian M. Monarch-1 activation in murine macrophage cell line (J774 A.1) infected with Iranian strain of Leishmania major. Iran J Parasitol 2013;8:207-11.  Back to cited text no. 5
    
6.
Yaghoobi-Ershadi M. Phlebotomine sand flies (Diptera: Psychodidae) in Iran and their Role on Leishmania transmission. J Arthropod Borne Dis 2012;6:1-17.  Back to cited text no. 6
    
7.
Mahmoodi MR, Mohajery M, Afshari JT, Shakeri MT, Panah MJ, Berenji F, et al. Molecular identification of Leishmania species causing cutaneous leishmaniasis in Mashhad, Iran. Jundishapur J Microbiol 2010;3:195-200.  Back to cited text no. 7
    
8.
Mohajery M, Shamsian SA, Rezaee A, Hasanpoor K, Shakeri MT, Farnoosh G, et al. Evaluation of mulecular epidemiology of cutaneous leishmaniasis in Sabzevar. Med J Mashhad Univ Med Sci 2010;53:138-44.  Back to cited text no. 8
    
9.
Bensoussan E, Nasereddin A, Jonas F, Schnur LF, Jaffe CL. Comparison of PCR assays for diagnosis of cutaneous leishmaniasis. J Clin Microbiol 2006;44:1435-9.  Back to cited text no. 9
    
10.
Aransay AM, Scoulica E, Tselentis Y. Detection and identification of Leishmania DNA within naturally infected sand flies by seminested PCR on minicircle kinetoplastic DNA. Appl Environ Microbiol 2000;66:1933-8.  Back to cited text no. 10
    
11.
Mohaghegh M, Fata A, Salehi G, Berenji F, Bazzaz MM, Rafatpanah H, et al. Molecular identification of Leishmania species using samples obtained from negative stained smears. Iran J Parasitol 2013;8:337-41.  Back to cited text no. 11
    
12.
Weigle KA, Labrada LA, Lozano C, Santrich C, Barker DC. PCR-based diagnosis of acute and chronic cutaneous leishmaniasis caused by Leishmania (Viannia). J Clin Microbiol 2002;40:601-6.  Back to cited text no. 12
    
13.
Hoseini Farash BR, Mohajery M, Fata A, Shamsian SA, Rezaee A, Yazdanpanah MJ. Anthroponotic cutaneous leishmaniasis in torghabeh-shandiz, a region with rural texture (a molecular study). Jundishapur J Microbiol 2013;6:e8274.  Back to cited text no. 13
    
14.
Teles CB, Basano SA, Zagonel-Oliveira M, Campos JJ, Oliveira AF, Freitas RA, et al. Epidemiological aspects of American cutaneous leishmaniasis and phlebotomine sandfly population, in the municipality of Monte Negro, State of Rondônia, Brazil. Rev Soc Bras Med Trop 2013;46:60-6.  Back to cited text no. 14
    
15.
Rassi Y, Javadian E, Jalali M, Motazedian M, Vatandoost H. Investigation on zoonotic cutaneous leishmaniasis, Southern Iran. Iran J Publ Health 2004;33:31-5.  Back to cited text no. 15
    
16.
Kazemi-Rad E, Mohebali M, Hajjaran H, Rezaei S, Mamishi S. Diagnosis and characterization of Leishmania species in Giemsa-stained slides by PCR-RFLP. Iran J Publ Health 2008;37:54-60.  Back to cited text no. 16
    
17.
Volpini AC, Marques MJ, Lopes dos Santos S, Machado-Coelho GL, Mayrink W, Romanha AJ. Leishmania identification by PCR of Giemsa-stained lesion imprint slides stored for up to 36 years. Clin Microbiol Infect 2006;12:815-8.  Back to cited text no. 17
    
18.
Ajaoud M, Es-sette N, Hamdi S, El-Idrissi AL, Riyad M, Lemrani M. Detection and molecular typing of Leishmania tropica from Phlebotomus sergenti and lesions of cutaneous leishmaniasis in an emerging focus of Morocco. Parasit Vectors 2013;6:217.  Back to cited text no. 18
    
19.
Kheirandish F, Chegeni Sharafi A, Kazemi B, Mohebali M, Sarlak A, Tarahi MJ, et al. Identification of Leishmania species using PCR assay on giemsa-stained slides prepared from cutaneous leishmaniasis patients. Iran J Parasitol 2013;8:382-8.  Back to cited text no. 19
    
20.
Fazaeli A, Fouladi B, Hashemi-Shahri S, Sharifi I. Clinical features of cutaneous leishmaniasis and direct PCR-based identification of parasite species in a new focus in southeast of Iran. Iran J Publ Health 2008;37:44-51.  Back to cited text no. 20
    
21.
Ghasemian M, Maraghi S, Samarbafzadeh AR, Jelowdar A, Kalantari M. The PCR-based detection and identification of the parasites causing human cutaneous leishmaniasis in the Iranian city of Ahvaz. Ann Trop Med Parasitol 2011;105:209-15.  Back to cited text no. 21
    
22.
Fata A, Khamesipour A, Mohajery M, Hosseininejad Z, Afzalaghaei M, Berenji F, et al. Whatman paper (FTA cards) for storing and transferring Leishmania DNA for PCR examination. Iran J Parasitol 2009;4:37-42.  Back to cited text no. 22
    
23.
Karamian M, Motazedian MH, Fakhar M, Pakshir K, Jowkar F, Rezanezhad H. Atypical presentation of Old-World cutaneous leishmaniasis, diagnosis and species identification by PCR. J Eur Acad Dermatol Venereol 2008;22:958-62.  Back to cited text no. 23
    
24.
Tohidi F, Barghae A. Cutaneous leishmaniasis Parasite Identification via PCR in the infected areas in Golestan province Knowledge and Health 2011;6:26-31.  Back to cited text no. 24
    
25.
Mesgarian F, Rahbarian N, Mahmoudi M, Hajaran H, Shahbaz F, Mesgarian Z, et al. Identification of Leishmania species isolated from human cutaneous leishmaniasis in Gonbad-e-Qabus city using a PCR method during 2006-2007. Tehran Univ Med J 2010;68:250-6.  Back to cited text no. 25
    
26.
Pagheh AS, Fakhar M, Mesgarian F, Rahimi-esboei B, Badiee F. Incidence trend of rural cutaneous leishmaniasis in Gonbad-e-Qabus city, (Golestan, Iran) during 2009-2012. J Mazandaran Univ Med Sci (JMUMS) 2013;23:27-33.  Back to cited text no. 26
    
27.
Fata A, Rakhshandeh H, Berenji F, Jalalianfard A. Treatment of cutaneous leishmaniasis in murine model by alcoholic extract of Berberis vulgaris. Iran J Parasitol 2006;1:39-42.  Back to cited text no. 27
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2]


This article has been cited by
1 In Vitro Antileishmanial Activity of Falcaria vulgaris Fractions on Leishmania major
Abbas Ali Eskandarian,Hamed Jafari,Gholamreza Asghari,Mohammad Ali Mohaghegh,Mustafa Ghanadian,Hosein Ali Yousefi,Roghiyeh Faridnia,Hamed Kalani
Jundishapur Journal of Natural Pharmaceutical Products. 2017; 12(3)
[Pubmed] | [DOI]
2 Identification of Leishmania Species for Cutaneous leishmaniasis in Gonabad, Bardaskan and Kashmar, Central Khorasan, 2015
Abdolrahim Rezai,Elham Moghaddas,Mohammad Reza Bagherpor,Ali Naseri,Seyed Aliakbar Shamsian
Jundishapur Journal of Microbiology. 2017; In press(In press)
[Pubmed] | [DOI]
3 In vitro anti-leishmanial activity of Satureja hortensis and Artemisia dracunculus extracts on Leishmania major promastigotes
Farzaneh Mirzaei,Ali Fattahi Bafghi,Mohammad Ali Mohaghegh,Hossein Zarei Jaliani,Roghiyeh Faridnia,Hamed Kalani
Journal of Parasitic Diseases. 2016;
[Pubmed] | [DOI]



 

Top
  
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Introduction
   Sampling
   Parasitological test
   DNA extraction
    Polymerase chain...
   Results
   Discussion
   Conclusion
   Acknowledgment
    Materials and me...
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed3757    
    Printed36    
    Emailed1    
    PDF Downloaded28    
    Comments [Add]    
    Cited by others 3    

Recommend this journal